TMCnet News
Development of primary cell cultures from mud crab, Scylla serrata, and their potential as an in vitro model for the replication of white spot syndrome virus [In Vitro Cellular & Developmental Biology](In Vitro Cellular & Developmental Biology Via Acquire Media NewsEdge) Abstract Primary cell cultures were developed from haemocytes and testis of Scylla serrata . Haemocytes were collected from live animals and cultured in double-strength L-15 medium (2x L-15) prepared in crab saline, supplemented with 5% foetal bovine serum and antibiotic-antimycotic solution (penicillin 100 U/mL, streptomycin 100 µg/mL and amphotericin B 0.25 µg/mL) with osmolality adjusted to 894 mOsm/kg. The haemocytes adhered within 2 h after seeding and showed proliferation up to 72 h. The disaggregated testis tissue fragments were seeded in 3x L-15 supplemented with non-essential amino acid mixture, lipid concentrate and antibiotic-antimycotic solution, with osmolality adjusted to 1,035 mOsm/kg with crab saline. Cells from the testis could be subcultured and maintained up to 21 d as suspension culture. Different dilutions of white spot syndrome virus (WSSV) inoculum (known virus copy number) prepared from infected Penaeus monodon were inoculated in the cultured cells, and the cytopathic effects like detachment, rounding of cells and clear areas of depleted cells were observed after 48 h in haemocyte cultures. However, WSSVexposed testis cells did not show any obvious change until 72 h post-infection. WSSV was detected in both haemocyte and testis cultures at different time-points of infection by conventional and real-time PCR using WSSV-specific primers. The transcripts of WSSV were found to be much higher in haemocytes than in testis culture. The virus harvested from the cultured haemocytes after three passages could infect healthy P. monodon. The present study showed that mud crab haemocyte culture can support WSSV replication, and it can be used as an in vitro tool for WSSV replication. Keywords Mud crab * Scylla serrata * Primary cell culture * WSSVreplication Introduction Crustaceans dominated by shrimps are important for aquaculture due to their high nutritional value and consumer preference worldwide. However, disease outbreaks caused by viruses, especially white spot syndrome virus (WSSV), are of major concern, considering that this virus produces high mortality in infected shrimps, causing huge economic losses in aquaculture (Flegel 2006; Walker and Winton 2010). Although considerable progress has been made in understanding the viral structural proteins and genome, little is known about the mechanism of infection and pathogenesis. One of the major obstacles is the lack of appropriate cell lines for WSSV infection and proliferation. Although many diagnostic methods are available for the detection of WSSV, crustacean cell cultures offer great potential as a model for the development of diagnostic reagents and probes for use in shrimp, crayfish and lobster industries (Toullec 1999). The development of primary culture systems for the replication of the virus in vitro combined with PCR-based analysis for the screening or confirmation of WSSV infection can be considered as one of the most sensitive methods for understanding the mechanism of infection and pathogenesis of WSSV. There have been many attempts at developing cell lines from penaeid shrimps with limited success (Owens and Smith 1999). Primary cultures have been reported from the haemocytes of Penaeus monodon (Jose et al. 2010)andPenaeus chinensis (Jiang et al. 2006) as well as the tissues of P. monodon (Chen et al. 1986; Kasornchandra and Boonyaratpalin 1998; Uma et al. Electronic supplementary material The online version of this article (doi:10.1007/s11626-013-9718-x) contains supplementary material, which is available to authorized users. 2002)andMarsupenaeus japonicus (Itami et al. 1999;Maeda et al. 2004) for the replication of WSSV. However, successful attempts at developing cell cultures from crabs are very few, and these include the development of primary cultures from the hepatopancreas of mud crabs (Sashikumar and Desai 2008;Zengetal.2010) and the haemocytes of blue crab (Wenli and Shields 2007). We have chosen mud crab, Scylla serrata, as the model organism to develop primary cell cultures, as the species is reported to be less susceptible to WSSV than the penaeid shrimps (Rajendran et al. 1999). Therefore, the objectives of the present study were to establish primary cultures from different tissues/cells of mud crab and to understand whether these cells would support WSSV replication. Materials and Methods Animals. Live and healthy mud crabs, S. serrata (weighing 70-90 g), were collected from the creeks located in Versova, Mumbai, India, and acclimatised in the laboratory in aquaria with seawater and sand-mud mixture as bottom substrate. Juvenile P.monodon were collected from commercial growout farms near Mumbai and were maintained in FRP tanks with seawater and under continuous aeration. Media and supplements. Different media such as Leibovitz L-15, Grace's insect medium, Sf-900(TM) II (serum-free medium) and M-199 with various combinations of supplements such as 5-20% foetal bovine serum (FBS), crab haemolymph serum, crab muscle extract, lipid concentrate, yeastolate, non-essential amino acid mixture, essential amino acid mixture and vitamin mixture, with antibiotic-antimycotic solution (penicillin 100 U/mL, streptomycin 100 µg/mL and amphotericin B 0.25 µg/mL), were used for culturing the different cells/tissues of mud crab. Crab haemolymph serum was prepared from the haemolymph drawn from live crabs. The haemolymph was allowed to clot at room temperature and stored at 4°C for 30 min. The serum was separated by centrifugation at 4,000xg for 5 min at 4°C. The separated haemolymph serum was filtered through a 0.22-µmsyringe filter, and the filtered serum was used as a supplement in the culture medium. Crab muscle extract was prepared by homogenizing 10 g muscle in 50 mL double-strength L-15 (2x L-15), clarified by centrifugation at 12,000xg for 20 min at 4°C and filtered through 0.22-µm filter. All the other supplements and media as well as the antibiotic-antimycotic solution were procured commercially (Gibco, Carlsbad, CA). Crab saline, used for adjusting the osmolality of the media, was constituted with440 mM NaCl,11.3 mM KCl, 26mM MgCl2,13.3mM CaCl2,23mMNa2SO4 and 10 mM HEPES and was sterilised by filtration through a 0.22-µm filter. All the chemicals used in the study were of cell culture grade (Sigma, St. Louis, MO). The osmolality of the media and the supplements was measured using a cryoscopic osmometer, OSMOMAT® 030 (Gonotec, Berlin, Germany). Primary haemocyte culture. The animals were hydrated by immersing in sterile crab saline containing 1x antibiotic- antimycotic solution for 10 min and surface-sterilised by swabbing with 70% alcohol. Haemolymph was withdrawn aseptically, from the coxa of swimming legs of live animals using a sterile syringe with a 24-gauge needle, into an equal volume of the anticoagulant constituted with 0.3 M NaCl, 0.1 M glucose, 30 mM sodium citrate, 26 mM citric acid and 10 mM EDTA pH 5.4 (Wenli and Shields 2007). Haemocytes were collected by centrifugation at 400xg for 3 min and gently resuspended in different media containing the supplements. The live cells were counted using a haemocytometer by trypan blue dye exclusion method. The haemocytes were seeded in six-well tissue culture plates (BD Primaria(TM), BD Biosciences, San Jose, CA) at a concentration of approximately 2 x 106 live cells/well and incubated at 28°C. The cells were maintained by replacing 50% of the spent medium with fresh medium, depending on the cell proliferation. Primary testis cell culture. The animals were anaesthetised using diethyl ether, and the disinfection of the whole animal was done as described by Sashikumar and Desai (2008). The animals were rinsed in 2% (w /v) potassium permanganate solution for 10 min and immersed in sterile crab saline containing antibiotic-antimycotic solution followed by washing with sterile artificial seawater (480 mM NaCl, 10 mM KCl, 20 mM MgCl2·6H2O, 30 mM MgSO4·7H2O). The animals were surface-sterilised with 70% alcohol and dissected out in a laminar hood to collect the organs. The testis was excised aseptically and transferred to a sterile Petri plate containing the medium. The tissue was subjected to mechanical dissociation using sterile scissors and forceps. The tissue fragments, suspended in the medium, were dissociated by repeatedly passing through a sterile 10-mL pipette to obtain single-cell suspensions and then washed thrice in the medium. After the final wash, the cells were resuspended in different growth media containing supplements, transferred to tissue culture flasks (BD Primaria(TM)) and incubated at 28°C. After 18 h, the cells proliferating as suspension cells were separated from the attached explants and filtered through a sterile 40-µmpore size cell strainer to remove cell clumps. The cell viability was evaluated by trypan blue dye exclusion method, and the cells were seeded at a concentration of 2x106 cells/well. Attached explant cultures were maintained by replacing 50% medium with fresh growth medium every 3 d. The cells in suspension were maintained by splitting the cells 1:2 or 1:5 depending on the cell density as observed under an inverted phase-contrast microscope. MTT assay for the estimation of cell proliferation. Cell proliferation in the primary cultures was determined by the reduction of MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide] by viable cells. Haemocytes and testis cells were collected as described above and suspended in different media with supplements. An aliquot (200 µL) of cell suspension was seeded in each well in a 96-well tissue culture plate (BD Primaria(TM))toget105 cells/well and incubated at 28°C. Six replicates were maintained for each medium. The MTT assay was carried out at different time-points after seeding (0, 24, 48 and 72 h) using the Cell Growth Determination Kit (Sigma). According to the manufacturer's protocol, 20 µLof MTT dye was added into each well and incubated for 4 h. After incubation, the purple formazan crystals formed were dissolved by adding 200 µL of solubilization buffer in each well, and the absorbance was measured at dual wavelength of 570 and 690 nm using an ELISA plate reader (Biotek, Winooski, VT). The results were derived from the average of six-well replicates for each sample, and the data were analysed using SPSS software version 16.0 (SPSS Inc., Chicago, IL). Preparation of WSSV inoculum from P. monodon . Healthy P.monodon were injected intramuscularly with 100 µLof WSSV inoculum and maintained in an aquarium with seawater till they showed visible symptoms of white spot disease and mortality. Gill and epithelial layer from the infected animal (tested positive by PCR) were homogenised in 1 mL cold 2x L-15 medium using mortar and pestle on ice. The homogenate was clarified twice by centrifugation at 8,000xg for 20 min at 4°C. The supernatant obtained was filtered using a 0.45-µm syringe filter, aseptically transferred to sterile micro-centrifuge tubes and stored at -80°C until further use. An aliquot of the inoculum was used to quantify the viral load. In vitro infection of haemocytes and testis cells with WSSV. The haemocytes seeded in six-well plates (BD Primaria(TM)) were observed to adhere within 2 h after seeding. The attached cells were exposed to 200 µL of different dilutions (10-0,10-0.5,10-1,10-2,10-3,10-4,10-5)ofWSSV inoculum in serum-free 2x L-15 medium and incubated at 28° C. After 2 h, the inoculum was removed, and the cells were washed twice with the medium. The cells were supplemented with fresh growth medium and incubated at 28°C. Testis cells in suspension were collected by centrifugation at 400xg for 3 min and resuspended in 200 µL WSSV inoculum for 2 h. The cells were then washed twice by centrifugation and resuspended in growth medium. The viable cells were counted, and aliquots of 2x106 cells were seeded in each well in sixwell plates in the growth medium. Control wells for the haemocytes and testis cells were treated with the culture medium instead of WSSV inoculum. Samples were collected at different time-points of infection, and the viral load was quantified using real-time PCR. PassagingofWSSVinculturedhaemocytes.Primary haemocyte cultures infected with WSSV were harvested 48 h post-infection. The cells in the wells were subjected to repeated freeze-thaw cycles to lyse the cells and release the virus into the supernatant. The cell debris was pelleted by centrifugation (8,000xg for 5 min at 4°C). The cell-free supernatant was filtered through a 0.45-µm syringe filter and was used to infect fresh primary haemocyte cultures. For this, the viral infection protocol as described earlier was followed. The exposed cells along with the medium were collected after 48 h, and the cell-free supernatant was prepared by repeated freeze-thawing and centrifugation. The supernatant was filtered through a 0.45-µm syringe filter and used in the subsequent challenge experiment. The DNA extracted from the supernatant was tested for WSSV using PCR, before the challenge experiment. Infection of P. monodon with virus propagated in crab haemocyte culture. The WSSV inoculum obtained after the third passage in haemocyte culture was used to infect healthy, WSSV-free P.monodon to verify the presence of infectious viral particles. About 100 µL cell-free filtered supernatant was injected intramuscularly into healthy, WSSV-free P.monodon and maintained in the laboratory. Control animals were injected with 100 µL medium used for preparing the inoculum. The animals were observed daily for symptoms of WSSV infection and mortality. Gill, lymphoid organ, stomach and epidermal tissue were collected from the animals at 24 h, 5 d and 7 d post-infection to test for WSSV infection. Isolation of DNA and RNA from WSSV-infected cells. The control and infected cells were harvested at different timepoints of infection to quantify the viral load. Haemocytes were harvested using cell scrapers while testis cells were collected by centrifugation. The cells collected from two wells were pooled to get samples for each time-point. DNA was isolated from the harvested cells of S. serrata and tissues of P. monodon using DNeasy® Blood and Tissue kit (Qiagen, Valencia, CA) and eluted in nuclease-free water. Total RNA was isolated from the haemocytes and testis cells of S. serrata using RNeasy® RNA Minikit (Qiagen) following the manufacturer's protocol and eluted in nuclease-free water. The isolated nucleic acids were quantified using a NanoDrop-2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA). Conventional PCR and RT-PCR for WSSV detection. PCR amplification was carried out using specific primers for WSSV detection. Equal quantity of DNA template (50 ng) was used in a25-µLreactionconsistingof25pmoleachofforward and reverseprimers(Vp28F15?CGAAACCCACACAGGCAATA 3?;Vp28R1-5?-CCACGGGAGTGATGACAAGA-3?), 2.0 mM MgCl2,200µM dNTPs and 1 U Taq Polymerase (Invitrogen, Carlsbad, CA). The PCR was carried out at 95°C for5minfollowedby40cyclesof95°Cfor30s,55°Cfor30s and72°Cfor30sfollowedbyfinalextensionat72°Cfor7min. The PCR products were analysed by agarose gel electrophoresis. For reverse-transcriptase PCR (RT-PCR), 500 ng total RNA was reverse-transcribed using Superscript® III reverse transcriptase and random hexamer primer (Invitrogen, Carlsbad, CA) following the manufacturer's protocol. Quantification of WSSV copy number using real-time PCR. Viral copy number in WSSV inoculum, infected cultured cells of S. serrata as well as in gill, lymphoid organ, stomach and epidermal tissues of experimentally infected P.monodon, was determined by quantitative real-time PCR, which was developed and standardised in our laboratory. A tenfold serially diluted plasmid DNA standard was used to generate the standard curve. Real-time PCR was performed using Taqman® Master Mix (Applied Biosystems, Foster city, CA) in a 20-µL reaction mixture containing 0.9 µMofeach primer and 0.25 µ M TaqMan probe having 5? 6carboxyfluorescein (FAM) reporter dye and 3? nonfluorescent quencher, NFQ (primer and probe sequences are not provided here as a patent application is being filed on this). Equal quantities of DNA (50 ng/µL) and cDNA (25 ng/µL) were used as template in the PCR. The reaction was carried out in a 96-well reaction plate using an ABI 7500 real-time PCR system (Applied Biosystems, Foster city, CA) set at default thermal profile. The absolute WSSV copy number in the experimental samples was determined using the standard curve. The WSSV copy number was determined from three sample replicates, and each sample replicate was further divided into two-well replicates. The data were analysed using SPSS software version 16.0. Results Media optimization for primary cultures. The osmolality of crab haemolymph serum was found to be 791 mOsm/kg. Accordingly, for culturing haemocytes and testis cells, Leibovitz L-15, Grace's insect medium, Sf-900(TM) II and M-199 were used as basal media with various combinations of supplements such as 5-20% FBS, crab haemolymph serum, crab muscle extract, lipid concentrate, non-essential and essential amino acid mixture, vitamin mixture, yeastolate, etc. Among the different media combinations, 2x L-15 prepared in modified crab saline (220 mM NaCl, 5.65 mM KCl, 13 mM MgCl2,6.65mMCaCl2, 11.5 mM Na2SO4, 5 mM HEPES) supplemented with 5% FBS was observed to be the most suitable medium for the culture of the haemocytes of S. serrata and hence used in all subsequent experiments. However, testis cells showed maximum proliferation and survival when cultured in triple-strength Leibovitz L-15 (3x L-15) medium prepared in distilled water supplemented with sterile non-essential amino acid mixture and lipid concentrate and was used in all subsequent experiments. The osmolality of haemocyte culture medium and testis culture medium was 894 and 1,035 mOsm/kg, respectively. The details of the media and supplements used and the performance of the cultured cells in each medium are given in Table 1. Primary cultures from haemocytes and testis cells. Haemocytes were observed to adhere within 2 h after seeding and spread to form a monolayer (Fig. 1). The cells were found to be viable and growing up to 72 h as observed under a microscope after which cell division could not be observed. Although the cells could be maintained as adherent cultures for 15 d, the cells lost their morphology after this. FBS was found to be essential as a supplement as it was observed that haemocytes maintained without serum supplementation showed degranulation after 18 h in culture and cell viability reduced after 48 h (Fig. 2). Crab haemolymph serum was used as a replacement for FBS. However, melanization was observed in the cells when cultured in the medium with crab haemolymph serum, singly or in combination with FBS, even at low concentrations. Since serum supplementation of 10-20% did not show any significant improvement in cell proliferation, a concentration of 5%, which did not alter the osmolality of the medium, was found to be sufficient for optimum cell growth. Cells supplemented with crab muscle extract did not show any significant improvement in culture. Attempts to subculture the cells were not successful as the detached cells were not able to reattach after subculturing. Testis cells showed proliferation and survived up to 21 d as suspension cultures, when cultured in 3x L-15 supplemented with 1x non-essential amino acid mixture, 1% lipid concentrate and crab saline (Fig. 3A, B). It was observed that addition of the serum is not essential for the survival of testis cells, as the cells cultured in 2x L-15 and 3x L-15 media containing serum even at a low concentration (5%) showed a gradual loss in viability as observed by the MTT assay (Fig. 4). The tissue explants were found to be attached and spread onto the substrate within 24 h. However, the cells did not proliferate subsequently. The dissociated tissue yielded spherical cells which were found to proliferate in suspension. The cells were subcultured at every 4-d intervals and could be maintained for 21 d following which a loss in cell viability was observed as detected by trypan blue dye exclusion assay. Replication of WSSV in haemocytes and testis. The viral copy number in the WSSV inoculum was determined by real-time PCR, and the inoculum was standardised for in vitro infection. The viral copy number in the inoculum was 2.4 x 103/µL. The haemocytes exposed to 10-1 dilution of WSSV inoculum showed cytopathic-like effects such as pigmentation, clumping and shrinkage which were not observed in the cells maintained as control (Fig. 5). Among the different dilutions of the virus inoculum tested, dilutions of 10-2-10-5 showed no significant difference in cell morphology when compared to the cells maintained as control. In some cases, such as in haemocytes infected with undiluted inoculum, the cell viability was found to be decreased drastically. With 10-1 dilution of WSSV inoculum, haemocytes were viable up to 3 d in culture. However, primary testis cell cultures exposed to the inoculum did not show any visible CPE and were found to retain their spherical morphology even at 72 h post-infection, when observed under an inverted phase-contrast microscope. Quantification of WSSV using real-time PCR. WSSV infection of haemocytes and testis cells at different time-points was detected by PCR with WSSV-specific primers. The viral load in WSSV-exposed haemocytes showed more than fivefold increase at 24 h post-infection compared to 2 h postinfection (Fig. 6). However, the viral copy number showed a decline at 48 and 72 h. In infected testis cells, WSSV copy number showed only twofold increase at 72 h compared to 2 h post-infection (Fig. 7). WSSV replication in the cultured haemocytes and testis cells was also analysed by RT-PCR. In haemocytes, high transcript abundance was noticed from 18 h until 72 h post-infection. The peak abundance was observed at 36 h post-infection followed by a decline at 48 h (Fig. 8). However, testis cells showed the highest transcript copies at 24 h post-infection followed by a decrease in level at 72 h (Fig. 9). Testis cells, in comparison to haemocytes, showed a very low level of transcripts at all time-points. It was also observed that unlike haemocytes, testis cells do not show any detectable level of the virus post-infection when exposed to a diluted WSSV inoculum (1:10). Confirmation of virus propagation in crab haemocyte culture. Replication and viability of the virus in haemocyte cultures were confirmed by passaging of infected haemocyte cultures and re-inoculation of the virus recovered from these cells in fresh primary cultures. WSSV-specific PCR revealed the presence of viral DNA in the infected cells up to three passage levels. However, the fourth passage was found to be negative in the PCR (Fig. 10). Real-time PCR was employed to quantify the viral copies in all the passages. Viral copies in the second passage were found to be less than the first, while the third passage showed an increase in the virus copies compared to the second. Although conventional PCR did not show any discernible amplification in the fourth passage, real-time PCR showed a very low but detectable level of the virus (Fig. 11). The cell-free supernatant prepared from infected cells was injected intramuscularly into healthy shrimp, P. monodon , and observed for signs of WSSV infection. Tissues such as gill tissue, epidermal tissue, stomach tissue and lymphoid organ tissue were collected from injected animalsat24h,5dand7dpost-challengeandweresubjected to PCR analysis. Injected animals showed reddish discolouration at 5 d post-infection. However, no white spots could be detected in any of the samples. When tested using conventional PCR, none of the tissue collected at earlier timepoints (24 h and 5 d) showed any detectable amplification (Fig. 12). However, all the tissues collected on the seventh day post-infection showed discernible amplification. In these, the intensity of infection was found to be more in lymphoid organ compared to the other tissues (Fig. 13). All the experimentally infected animals collected at the three time-points were further tested with real-time PCR. As observed in the conventional PCR, the lymphoid organ collected at 7 d post-infection showed the highest viral copy number compared to the other tissues tested. Although the infected animals collected at 24 h and 5 d post-infection did not show any detectable level of amplification in conventional PCR, real-time PCR showed low copy numbers (1 x 102 and 6.6 x 102 copies µg-1 DNA, respectively) of the virus. An increase in the viral load was observedinthetissuescollected7dafterinfectionascompared to 5 d after infection. Discussion Primary cell cultures were successfully developed from haemocytes and testis cells of S. serrata which could be maintained long enough to conduct preliminary viral infectivity studies. Various media, either synthetic or formulated, have been tried for the maintenance of crustacean cell cultures, L-15 and M-199 being the most commonly used media for primary culture from crustaceans (Toullec 1999). Although few earlier reports suggest M-199 as a suitable medium (Ke et al. 1990; Itami et al. 1999; Lang et al. 2002), doublestrength L-15 has been successfully used by many researchers for crustacean cell culture systems (Chen et al. 1986;Nadala et al. 1993; Hsu et al. 1995;Frerichs1996; Kasornchandra and Boonyaratpalin 1998; Fraser and Hall 1999; Owens and Smith 1999; Maeda et al. 2003; Jiang et al. 2006;Joseetal.2011). In the present study, double-strength L-15 and triple-strength L-15, supplemented with crab saline to adjust the osmolality, were found to support the growth and survival of haemocytes and testis cells, respectively. The osmolality of the medium was observed to be a critical parameter for the survival of the cells in vitro, and the haemocytes could be cultured in the medium with an osmolality of 894 mOsm/kg while testis cell cultures needed a higher range (1,035 mOsm/kg). Walton and Smith (1999) showed that the haemocytes of marine decapods could be cultured in L-15 with supplements at an osmolality of 925 mOsm/kg which is much higher than that used for shrimp cell culture media by Roper et al. (2001). Supplementing media with crab saline has been reported to increase the survival of the primary hepatopancreas cultures of mud crab (Sashikumar and Desai 2008). Zeng et al. (2010) formulated a modified L-15 medium for the primary culture of the hepatopancreas of Scylla paramamosain and adjusted the osmolality with D Hanks solution. FBS (5-20%) has been the most widely used growth supplement for primary crustacean cell cultures (Toullec 1999). However, in the present study, it was observed that the testis cell cultures of S. serrata do not require serum supplementation. The primary haemocyte cultures from shrimps have been reported to be viable for 8 d (Jose et al. 2011) or 20 d (Jiang et al. 2006)with20%FBS supplementation and for 48 d with 10% FBS + 10% shrimp muscle extract (George and Dhar 2010), whereas 60% viability has been observed up to 14 d in the haemocyte cultures of blue crab (Wenli and Shields 2007), and 70% viability has been observed up to 14 d in haemocyte cultures of two marine decapods (Walton and Smith 1999). The only other report on the primary testis cell culture from S. serrata showed cell viability of 5 mo (Shashikumar and Desai 2011). However, the culture medium with the same composition as reported by these authors did not show any improvement in the viability of testis cells in our study. The haemocytes from S. serrata could be maintained in vitro up to 15 d, but cell viability decreased after 72 h. Although the haemocyte cultures could be maintained only for a short term as primary cultures, these showed better susceptibility to WSSV as compared to testis cell cultures and could be effectively used for infection trials. Many emerging viruses, in addition to previously known ones, are posing threats to the aquaculture industry. The lack of standardised systems for the isolation, identification and purification of the causative agent is the major obstacle for the diagnosis and prevention of viral diseases. One of the main goals of development of crustacean cell cultures is to isolate and identify viruses. Cell lines from vertebrates are routinely used for virus isolation and identification as many cell lines are available to propagate the virus in vitro. As no crustacean cell line is available, studies on the pathogenicity of crustacean viruses have been carried out in primary cultures. There have been many experimental studies on WSSV infection in crustacean primary cultures- haemocyte cultures from P.monodon (Jose et al. 2010)andP.chinensis (Jiang et al. 2006), lymphoid organs from P. monodon (Kasornchandra and Boonyaratpalin 1998;Joseetal.2012)andM. japonicus (Itami et al. 1999) as well as ovarian cultures of M. japonicus (Maeda et al. 2004) and explant culture from the heart of the freshwater crab, Paratelphusa hydrodomous (Nambi et al. 2012). Cytopathic effects were reported in P. monodon haemocytes within a few hours of infection, and it included cell shrinkage and disintegration (Jose et al. 2010) while Jiang et al. (2006) observed cell detachment from the substrate and cell debris formation in P. chinensis 2 d after infection. In both the cases, the lower dilutions of the virus inoculum resulted in increased CPE while higher dilutions resulted in less or no CPE. Similar cytopathic effects were observed in crab haemocytes after 24 h of WSSV infection. However, no such effect was noticed in testis cells, and cell viability was found to belastingbeyond72h. Further evidence of virus replication was observed in WSSV-infected haemocytes as the virus copy number increased substantially (fivefold) at 24 h post-infection. Although a decline in the viral copy number was noticed at subsequent time-points, this could be attributed to the increased cytopathic effect and the non-availability of sufficient cells for virus replication at the later stage of infection. On the contrary, testis cells showed the maximum viral copies at 72 h post-infection. This trend could be due to the fact that testis cells did not show any cytopathic effect and virus replication as observed by the increase in copy number which was not as pronounced as that in haemocytes. As far as is known, the present report provides the first evidence of the susceptibility of the cells of the mud crab, S. serrata ,toWSSVinvitro. Although crabs carry WSSV, the virus does not cause severe mortality as is observed in penaeid shrimps. The propagation of WSSV in crabs can be utilised as a tool to elucidate the mechanism of resistance of crabs to WSSV. In a parallel study undertaken in our laboratory, we have observed that WSSV copies in the infected haemocytes of S. serrata are considerably less (five to eightfold) than those of infected P.monodon haemocytes (data not presented). This explains the fact that crabs remain carriers of the virus, and they can tolerate the infection probably because the viral loads are not high enough. In the present study, to test the viability of the virus in cultured cells, the virus was passaged multiple times in cultured haemocytes. The DNA extracted from cell-free supernatant showed discernible PCR amplification until three passages. Although the fourth passage was found to be negative for WSSV in conventional PCR, a low but detectable level of the virus was observed in real-time PCR. Further, P.monodon injected with cell-free virus suspension recovered from WSSV-infected haemocyte cultures after three passages and tested positive for infection indicating that the virus can replicate in the primary haemocyte cultures of S. serrata and that the virus retains the infectivity to P. monodon. This is the first report of a successful cross-infection bioassay using WSSV replicated in cultured cells. Further, we have used the primary haemocyte culture to study the efficacy of some of the antisense constructs against WSSV in silencing the virus (Ahanger et al. 2013) and also to elucidate the ligand specificity of mud crab TLR (unpublished). And, therefore, it can be concluded that primary haemocyte cultures of S. serrata can be used as an in vitro model for WSSV replication and other related studies like gene silencing. Further, it was observed that several factors such as virus titre, duration of the animal in captivity before using them for cell culture and the ambient temperature of rearing of animals influence the viability of the cultured cells and the susceptibility of cells of S. serrata to WSSV. Although improvement in media and culture conditions has resulted in extending the life of the cells in vitro, continuous efforts are required to establish cell lines and to study the limiting factors influencing WSSV replication in S. serrata . Acknowledgments The authors acknowledge the funding support of the National Agricultural Innovation Project, ICAR. The authors also acknowledge Dr. W.S. Lakra, Director, Central Institute of Fisheries Education, for providing the necessary support and facilities. References Ahanger S.; Sandaka S.; Ananad D.; Mani M. K.; Kondadhasula R.; Reddy C. S.; Marappan M.; Valappil R. K.; Majumdar K. C.; Mishra R. K. Protection of shrimp, Penaeus monodon from WSSV infection using antisense constructs. Mar. Biotechnol. 2013. doi:10.1007/ s10126-013-9529-9. Chen S. N.; Chi S. C.; Kou G. H.; Liao I. C. Cell culture from tissues of grass prawn Penaeus monodon. Fish Pathol. 21: 161-166; 1986. Flegel T. W. Detection of major penaeid shrimp viruses in Asia, a historical perspective with emphasis on Thailand. Aquaculture 258: 1-33; 2006. Fraser C. A.; Hall M. R. Studies on primary cell cultures derived from ovarian tissue of Penaeus monodon. Meth. Cell. Sci. 21: 213-218; 1999. Frerichs G. N. In vitro culture of embryonic cells from the freshwater prawn Macrobrachium rosenbergii. Aquaculture 143: 227-232; 1996. George S. K.; Dhar A. K. An improved method of cell culture system from eye stalk, hepatopancreas, muscle, ovary, and hemocytes of Penaeus vannamei. In Vitro Cell. Dev. Biol. Anim. 46: 801-810; 2010. Hsu Y. L.;Yang Y.H.;Chen Y. C.;Tung M. C.; Wu J.L.; EngelkingM. H.; Leong J. C. Development of an in vitro subculture system for the oka organ (lymphoid tissue) of Penaeus monodon. Aquaculture 136: 43-55; 1995. Itami T.; Maeda M.; Kondo M.; Takahashi Y. Primary culture of lymphoid organ cells and haemocytes of kuruma shrimp Penaeus japonicus. Meth. Cell. Sci. 21: 237-244; 1999. Jiang Y. S.; Zhan W. B.; Wang S. B.; Xing J. Development of primary shrimp hemocyte cultures of Penaeus chinensis to study white spot syndrome virus (WSSV) infection. Aquaculture 253: 114-119; 2006. Jose S.; Jayesh P.; Mohandas A.; Philip R.; Bright Singh I. S. Application of primary haemocyte culture of Penaeus monodon in the assessment of cytotoxicity and genotoxicity of heavy metals and pesticides. Mar. Environ. Res. 71: 169-177; 2011. Jose S.; Jayesh P.; Sudheer N. S.; Poulose G.; Mohandas A.; Philip R.; Bright Singh I. S. Lymphoid organ cell culture system from Penaeus monodon (Fabricius) as a platform for white spot syndrome virus and shrimp immune-related gene expression. J. Fish Dis. 35: 321- 334; 2012. Jose S.; Mohandas A.; Philip R.; Bright Singh I. S. Primary hemocyte culture of Penaeus monodon as an in vitro model for white spot syndrome virus titration, viral and immune related gene expression and cytotoxicity assays. J. Invertebr. Pathol. 105: 312-321; 2010. Kasornchandra J.; Boonyaratpalin S. Primary shrimp cell culture: application for studying white spot syndrome virus (WSSV). In: Flegel T. W. (ed) Advances in shrimp biotechnology. National Center for Genetic Engineering and Biotechnology, Bangkok, pp 273-276; 1998. Ke H.; Liping W.; Yumei D.; Shuji Z. Studies on a cell culture from the hepatopancreas of the Oriental shrimp Penaeus orientalis Kishinouye. Asian Fish. Sci. 3: 299-307; 1990. Lang G.; Nomura N.; Matsumura M. Growth by cell division in shrimp (Penaeus japonicus ) cell culture. Aquaculture 213: 73-83; 2002. Maeda M.; Mizuki E.; Itami T.; Ohba M. Ovarian primary tissue of the kuruma shrimp Marsupenaeus japonicus. In Vitro Cell. Dev. Biol. Anim. 39: 208-212; 2003. Maeda M.; Saitoh H.; Mizuki E.; Itami T.; Ohba M. Replication of white spot syndrome virus in ovarian primary cultures from the kuruma shrimp Marsupenaeus japonicus. J. Virol. Methods 116: 89-94; 2004. Nadala E. C.; Loh P. C.; Lu Y. Primary culture of lymphoid, nerve and ovary cells from Penaeus stylirostris and Penaeus vannamei. In Vitro Dev. Biol. Anim. 29A: 620-622; 1993. Nambi K. S.; Nathiga S.; Majeed A.; Sundar R. N.; Taju G.; Madan N.; Vimal S.; Hameed A. S. In vitro white spot syndrome virus (WSSV) replication in explants of the heart of freshwater crab. Paratelphusa hydrodomous. J. Virol. Methods 183: 186-195; 2012. Owens L.; Smith J. Early attempts at production of prawn cell lines. Meth. Cell Sci. 21: 207-211; 1999. Rajendran K. V.; Viiayan K. K.; Santiago T. C.; Krol R. M. Experimental host range and histopathology of white spot syndrome virus (WSSV) infection in shrimp, prawns, crabs and lobsters from India. J. Fish Dis. 22: 133-191; 1999. Roper K. G.; Owens L.; West L. The media used in primary cell cultures of prawn tissues: a review and a comparative study. Asian Fish. Sci. 14: 61-75; 2001. Sashikumar A.; Desai P. V. Development of primary cell culture from Scylla serrata: primary cell cultures from Scylla serrata. Cytotechnology 56: 161-169; 2008. Shashikumar A.; Desai P. V. Development of cell line from the testicular tissues of crab Scylla serrata. Cytotechnology 63: 473-480; 2011. Toullec J. Y. Crustacean primary cell culture: a technical approach. Meth. Cell Sci. 21: 193-198; 1999. Uma A.; Prabhakar T. G.; Koteeswaran A.; Ravi K. G. Establishment of primary cell culture from hepatopancreas of Penaeus monodon for the study of white spot syndrome virus (WSSV). Asian Fish Sci. 15: 365-370; 2002. Walker P. J.; Winton J. R. Emerging viral diseases of fish and shrimp. Vet. Res. 41: 5; 2010. Walton A.; Smith V. J. Primary culture of the hyaline haemocytes from marine decapods. Fish Shellfish. Immunol. 9: 181-194; 1999. Wenli C.; Shields J. D. Characterisation and primary culture of hemocytes from the blue crab Callinectus sapidus .In:CaiSL(ed)5th World Chinese Symposium for Crustacean Aquaculture, Ocean Press, Beijing, China. Transactions of the Chinese Crustaceans Society 5: 25-35; 2007. Zeng H.; Ye H.; Li S.; Wang G.; Huang J. Hepatopancreas cell cultures from mud crab, Scylla paramamosain. In Vitro Cell Dev. Biol. Anim. 46: 431-437; 2010. Received: 13 June 2013 / Accepted: 1 December 2013 / Published online: 20 December 2013 / Editor: T. Okamoto © The Society for In Vitro Biology 2013 A. Deepika : M. Makesh : K. V. Rajendran (*) Central Institute of Fisheries Education, Panch Marg, off Yari Road, Versova, Andheri (W), Mumbai 400061, India e-mail: [email protected] (c) 2014 Society for In Vitro Biology |